Style |
---|
.primer454 {background-color:skyblue;}
.key454, .keyfixed454 {background-color:yellow;}
.mid454, .midfixed454 {background-color:goldenrod;}
.other454 {background-color:greenyellow;}
.p7 {background-color:0xEBFEBE;}
.fixed454, .keyfixed454, .midfixed454 {font-family:courier,monospace;}
|
...
Canonical ILLUMINA library design as of June 2012 (all 5'-3'), "TruSeq V3": NOTE all sequences shown are TOP STRAND 5' to 3'
Highlight |
---|
|
<P5 primer/capture site> |
Highlight |
---|
|
<Read1 primer site> |
<template - gDNA, RNA, amplicon, whatever>
Highlight |
---|
|
<Read2 primer site> |
Highlight |
---|
|
<P7 primer/capture site> |
If you'd like a different description, this one from the Tufts core facility is quite good.
Single index adaptor design on a standard Illumina HiSeq or MiSeq run
Highlight |
---|
|
P5 PCR primer/flowcell capture site: |
AATGATACGGCGACCACCGAGA
NONE.
Highlight |
---|
|
Read1 primer site: |
Either the small RNA sequencing primer site: (NEB: TCTACACGTTCAGAGTTCTACAGTCCGACGATCA or Other: CAGGTTCAGAGTTCTACAGTCCGACGATCA) OR the standard TruSeq Read 1 primer site: TCTACACTCTTTCCCTACACGACGCTCTTCCGATCT. Which to choose? The TruSeq Read 1 primer site is complementary to the Read 2 primer site, so if you are designing amplicons do NOT use the TruSeq Read 1 primer site, use the small RNA sequencing primer site.
- The insert to be sequenced
Highlight |
---|
|
Read2 primer site: |
Then the Index read primer site: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC (note the initial A is from the dA tailing of the insert and is not included in the index primer or adaptor sequences; note also the reverse-complement of this is the Read 2 sequencing primer, but the Read 2 sequencing primer includes the T corresponding to the dA insert tail so sequencing starts with the insert)
The index sequence (usually 6 bp) - see many examples below in the Barcodes section. Within a lane, image analysis works best with as much base diversity as possible.
Highlight |
---|
|
P7 PCR primer/flowcell capture site: |
ATCTCGTATGCCGTCTTCTGCTTG
Highlight |
---|
|
<P5 primer/capture site> |
Highlight |
---|
|
<Read1 primer site> |
<template - gDNA, RNA, amplicon, whatever>
Highlight |
---|
|
<Read2 primer site> |
Highlight |
---|
|
<P7 primer/capture site> |
Note: Highlighting provided prior to 6/2012 was incorrect. It showed the Barcode Read 2 sequence as GATCT when in fact it is downstream of that site. We apologize for the error.
Here is an example of a read-pair from an RNA-seq library generated from the NEB small RNA kit with an insert size of 62 nt:
...
Dual-index TruSeq (NOT Nextera) adaptor design on a standard Illumina PE HiSeq or MiSeq run
Highlight |
---|
|
P5 PCR primer/flowcell capture site: |
AATGATACGGCGACCACCGAGATCTACAC
Optional. Example: TAGATCGC. This is called "IndexRead2" because it is read after index read 1. The GSAF does not normally sequence this barcode - please request if you need it read. We have little guidance to offer on designs other than to re-use the same sequences as in the Index Read 1 site - base diversity is your friend.
Highlight |
---|
|
Read1 primer site: |
The standard TruSeq Read 1 primer site: ACACTCTTTCCCTACACGACGCTCTTCCGATCT. We are not sure at this point whether the small RNA primer site is compatible with dual-indexes or not.
- The remaining template elements are identical to the Single-index adaptor design above.
- Note that an artifact of this design is that a SINGLE index (I7 index) TS library will read the sequence "TCTTTC..." as the I5 index if it is run in dual-index mode.
Dual-index Nextera adaptor design (we believe these are compatible with Illumina V3 PE HiSeq or V2/V3 MiSeq run)
...