...
Note: Highlighting provided prior to 6/2012 was incorrect. It showed the Barcode Read 2 sequence as GATCT when in fact it is downstream of that site. We apologize for the error.
Here is an example of a read-pair from an RNA-seq library generated from the NEB small RNA kit with an insert size of 62 nt:
| Code Block |
|---|
Read 1 sequence (note adaptor sequence starting with "AGATCGGAA...")
AAGGGATCATAGACGGTATTTCTATGTAAACGAACAGTCGGGCGAGTCTCAGTGGGAGTTTCAGATCGGAAGAGCACACGTCTGAACTCCAGNCACCGATG
ACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCAGGGATCATAGACGGTATTTCTATGTAAACGAACAGTCGGGCGAGTCTCAGTGGGAGTTTC
Read 2 sequence, reverse complemented (note adaptor sequence RC ending with "...CCGACGATCA")
|
Dual-index adaptor design on a standard Illumina PE HiSeq or MiSeq run
...