Page Comparison

...

1. Highlight
   color red
   P5 PCR primer/flowcell capture site:

   AATGATACGGCGACCACCGAGA

2. Highlight
   color yellow
   IndexRead2:

   NONE.

3. Highlight
   color green
   Read1 primer site:

   Either the small RNA sequencing primer site: (NEB: TCTACACGTTCAGAGTTCTACAGTCCGACGATCA or Other[Illumina lists this but it is UNPROVEN: CAGGTTCAGAGTTCTACAGTCCGACGATCA]) OR the standard TruSeq Read 1 primer site: TCTACACTCTTTCCCTACACGACGCTCTTCCGATCT. Which to choose? The TruSeq Read 1 primer site is complementary to the Read 2 primer site, so if you are designing amplicons do NOT use the TruSeq Read 1 primer site, use the small RNA sequencing primer site.

4. The insert to be sequenced

5. Highlight
   color cyan
   Read2 primer site:

   Then the Index read primer site: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC (note the initial A is from the dA tailing of the insert and is not included in the index primer or adaptor sequences; note also the reverse-complement of this is the Read 2 sequencing primer, but the Read 2 sequencing primer includes the T corresponding to the dA insert tail so sequencing starts with the insert)

6. Highlight
   color blue
   IndexRead1:

   The index sequence (usually 6 bp) - see many examples below in the Barcodes section. Within a lane, image analysis works best with as much base diversity as possible.

7. Highlight
   color purple
   P7 PCR primer/flowcell capture site:

   ATCTCGTATGCCGTCTTCTGCTTG

...