...
Highlight color red P5 PCR primer/flowcell capture site: AATGATACGGCGACCACCGAGA
Highlight color yellow IndexRead2: NONE - as in do NOT put an index here. If you want to add an index here, use one of the "Dual-index" designs below.
Highlight color green Read1 primer site: Either the small RNA sequencing primer site: (NEB: TCTACACGTTCAGAGTTCTACAGTCCGACGATCA [Illumina lists this but it is UNPROVEN: CAGGTTCAGAGTTCTACAGTCCGACGATCA]) OR the standard TruSeq Read 1 primer site: TCTACACTCTTTCCCTACACGACGCTCTTCCGATCT. Which to choose? The TruSeq Read 1 primer site is complementary to the Read 2 primer site, so if you are designing amplicons do NOT use the TruSeq Read 1 primer site, use the small RNA sequencing primer site.
- The insert to be sequenced
Highlight color cyan Read2 primer site: Then the Index read primer site: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC (NOTE: the initial A is from the dA tailing of the insert and is not included in the index primer or adaptor sequences; note also the reverse-complement of this is the Read 2 sequencing primer, but the Read 2 sequencing primer includes the T corresponding to the dA insert tail so sequencing starts with the insert)
Highlight color blue IndexRead1: The index sequence (usually 6 bp) - see many examples below in the Barcodes section. Within a lane, image analysis works best with as much base diversity as possible.
Highlight color purple P7 PCR primer/flowcell capture site: ATCTCGTATGCCGTCTTCTGCTTG
...