Page Comparison

{style}
.primer454 {background-color:skyblue;}
.key454, .keyfixed454 {background-color:yellow;}
.mid454, .midfixed454 {background-color:goldenrod;}
.other454 {background-color:greenyellow;}
.p7 {background-color:0xEBFEBE;}
.fixed454, .keyfixed454, .midfixed454 {font-family:courier,monospace;}
{style}

If this page isn't formatted well on your screen, try shrinking the left side bar.

Canonical ILLUMINA library design as of June 2012 (all 5'-3'), "TruSeq V3": NOTE all sequences shown are TOP STRAND 5' to 3'

{highlight:red}<P5 primer/capture site>

{highlight

}

{highlight:yellow}<IndexRead2>{highlight}

{highlight:green}<Read1 primer site>{highlight}

{highlight:cyan}<Read2 primer site>{highlight}

{highlight:blue}<IndexRead1>{highlight}

{highlight:purple}<P7 primer/capture site>{highlight}

If you'd like a different description, this one from the Tufts core facility is quite good.

Single index adaptor design on a standard Illumina HiSeq or MiSeq run

1. P5 PCR

   Highlight
   red	red
   Wiki Markup
   {highlight:red}P5 PCR primer/flowcell capture site:{highlight}

   AATGATACGGCGACCACCGAGA
2. IndexRead2:

   Highlight
   yellow	yellow
   Wiki Markup
   {highlight:yellow}IndexRead2:{highlight}

   NONE.
3. Read1 primer site:

   Highlight
   green	green
   Wiki Markup
   {highlight:green}Read1 primer site:{highlight}

   Either the small RNA sequencing primer site: (NEB: TCTACACGTTCAGAGTTCTACAGTCCGACGATCA or Other: CAGGTTCAGAGTTCTACAGTCCGACGATCA) OR the standard TruSeq Read 1 primer site: TCTACACTCTTTCCCTACACGACGCTCTTCCGATCT. Which to choose? The TruSeq Read 1 primer site is complementary to the Read 2 primer site, so if you are designing amplicons do NOT use the TruSeq Read 1 primer site, use the small RNA sequencing primer site.
4. The insert to be sequenced

5. Wiki Markup
   {highlight
   :cyan	cyan	}Read2 primer site:{highlight}

   Then the Index read primer site: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC (note the initial A is from the dA tailing of the insert and is not included in the index primer or adaptor sequences; note also the reverse-complement of this is the Read 2 sequencing primer, but the Read 2 sequencing primer includes the T corresponding to the dA insert tail so sequencing starts with the insert)
6. IndexRead1:

   Highlight
   blue	blue
   Wiki Markup
   {highlight:blue}IndexRead1:{highlight}

   The index sequence (usually 6 bp) - see many examples below in the Barcodes section. Within a lane, image analysis works best with as much base diversity as possible.

7. Wiki Markup
   {highlight
   :purple	purple	}P7 PCR primer/flowcell capture site:{highlight}

   ATCTCGTATGCCGTCTTCTGCTTG

{highlight

:red

}<P5 primer/capture site>

{highlight

}

{highlight:yellow}<IndexRead2>{highlight}

{highlight:green}<Read1 primer site>{highlight}

{highlight:cyan}<Read2 primer site>{highlight}

{highlight:blue}<IndexRead1>{highlight}

{highlight:purple}<P7 primer/capture site>{highlight}

Note: Highlighting provided prior to 6/2012 was incorrect. It showed the Barcode Read 2 sequence as GATCT when in fact it is downstream of that site. We apologize for the error.

...

Dual-index adaptor design on a standard Illumina PE HiSeq or MiSeq run

1. P5 PCR

   Highlight
   red	red
   Wiki Markup
   {highlight:red}P5 PCR primer/flowcell capture site:{highlight}

   AATGATACGGCGACCACCGAGATCTACAC
2. IndexRead2:

   Highlight
   yellow	yellow
   Wiki Markup
   {highlight:yellow}IndexRead2:{highlight}

   Optional. Example: TAGATCGC. This is called "IndexRead2" because it is read after index read 1. The GSAF does not normally sequence this barcode - please request if you need it read. We have little guidance to offer on designs other than to re-use the same sequences as in the Index Read 1 site - base diversity is your friend.

3. Wiki Markup
   {highlight
   :green	green	}Read1 primer site:{highlight}

   The standard TruSeq Read 1 primer site: ACACTCTTTCCCTACACGACGCTCTTCCGATCT. We are not sure at this point whether the small RNA primer site is compatible with dual-indexes or not.
4. The remaining template elements are identical to the Single-index adaptor design above.

...