Versions Compared

Old Version 101

changes.mady.by.user Amelia W Hall

Saved on

compared with

New Version 102

changes.mady.by.user Amelia W Hall

Saved on

Key

  • This line was added.
  • This line was removed.
  • Formatting was changed.

...

Expand
titleclick here to see the code and output
Code Block
languagebash
titlesolution code
module load bedtools
bedtools bamtofastq -i yeast_pairedend_sort.mapped.q1.bam -fq yeast_pairedend_sort.mapped.q1.fastq #takes 1-2 minutes
more yeast_pairedend_sort.mapped.q1.fastq

Here is an example of two sequences (and their corresponding quality scores):

 

Code Block
languagebash
titletwo lines of a fastq file
@HWI-ST1097:127:C0W5VACXX:5:2212:10568:79659
TACCCTCCAATTACCCATATCCAACCCACTGCCACTTACCCTACCATTACCCTACCATCCACCATGACCTACTCACCATACTGTTCTTCTACCCACCATAT
+
CCCFFFFFHHHHHJJJJJIIJJJJIJJIJJIJJIIIIJJJIJJIJJIJJIJJJJJJJJJJIIGGIGEGAEHFEFFEFFFDEEE@CCEDCDDD>ACBBDCA@
@HWI-ST1097:127:C0W5VACXX:5:2115:19940:13862
TAGGGTAAGTTTGAGATGGTATATACCCTACCATCCACCATGACCTACTCACCATACTGTTCTTCTACCCACCATATTGAAACGCTAACAAATGATCGTAA
+
?B@DF2ADHFHHFHJIIIGCIHIGGIJJJJGHIIIGIJEHHIGGGAHEGGFGHIECGIJIIIJIIIIIJJJJJJE>EHDHEEEBCDD?CDDBDDDDDDCDB

As we discussed earlier, the top line is the identifier for the sequence produced, the second line defines which bases were produced, the third line indicates the strand the sequence is aligned to, and the fourth line indicates the ASCII based quality scores for each character in the second line.

...

bedtools bamtobed: converting a BAM file into a bed file

While it's useful to be able to look at the fastq file, many analyses will be easiest to perform in bed format.  Bed format is a simple tab delimited format that designates various properties about segments of the genome, defined by the chromosome, start coordinates and end coordinates.  Bedtools provides a simple utility to convert BAM files over into bed files, termed bamtobed.

...