Table of Contents |
---|
Exercise #3: PE alignment with BioITeam scripts
...
Tip | |||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| |||||||||||||||||
Use our summer school reservation (CoreNGS) when submitting batch jobs to get higher priority on the ls6 normal queue.
| align_bwa_illumina.sh 2021_06_05
Align Illumina SE or PE data with bwa. Produces a sorted, indexed,
duplicate-marked BAM file and various statistics files. Usage:
align_bwa_illumina.sh <aln_mode> <in_file> <out_pfx> <assembly> [ paired trim_sz trim_sz2 seq_fmt qual_fmt ]
Required arguments:
aln_mode Alignment mode, either global (bwa aln) or local (bwa mem).
in_file For single-end alignments, path to input sequence file.
For paired-end alignments using fastq, path to the the R1
fastq file which must contain the string 'R1' in its name.
The corresponding 'R2' must have the same path except for 'R1'.
out_pfx Desired prefix of output files in the current directory.
assembly One of hg38, hg19, hg38, mm10, mm9, sacCer3, sacCer1, ce11, ce10,
danRer7, hs_mirbase, mm_mirbase, or reference index prefix.
Optional arguments:
paired 0 = single end alignment (default); 1 = paired end.
trim_sz Size to trim reads to. Default 0 (no trimming)
trim_sz2 Size to trim R2 reads to for paired end alignments.
Defaults to trim_sz
seq_fmt Format of sequence file (fastq, bam or scarf). Default is
fastq if the input file has a '.fastq' extension; scarf
if it has a '.sequence.txt' extension.
qual_type Type of read quality scores (sanger, illumina or solexa).
Default is sanger for fastq, illumina for scarf.
Environment variables:
show_only 1 = only show what would be done (default not set)
aln_args other bowtie2 options (e.g. '-T 20' for mem, '-l 20' for aln)
no_markdup 1 = don't mark duplicates (default 0, mark duplicates)
run_fastqc 1 = run fastqc (default 0, don't run). Note that output
Note that the reservation name (CoreNGS) is different from the TACC allocation/project for this class, which is OTH21164. |
Table of Contents |
---|
Exercise #3: PE alignment with BioITeam scripts
Now that you've done everything the hard way, let's see how to do run an alignment pipeline using a BWA alignment script maintained by the BioITeam, /work/projects/BioITeam/common/script/align_bwa_illumina.sh. Type in the script name to see its usage.
Code Block | ||
---|---|---|
| ||
align_bwa_illumina.sh 2022_06_10 Align Illumina SE or PE data with bwa. Produces a sorted, indexed, duplicate-marked BAM file and various statistics files. Usage: align_bwa_illumina.sh <aln_mode> <in_file> <out_pfx> <assembly> [ paired trim_sz trim_sz2 seq_fmt qual_fmt ] Required arguments: aln_mode Alignment mode, either global (bwa aln) or local (bwa mem). in_file For single-end alignments, path to input sequence file. For paired-end alignments using fastq, path to the the R1 fastq file which must contain the string 'R1' in its name. The corresponding 'R2' must have the same path except for 'R1'. out_pfx Desired prefix of output files in the current directory. assembly One of hg38, hg19, hg38, mm10, mm9, sacCer3, sacCer1, ce11, ce10, danRer7, hs_mirbase, mm_mirbase, or reference index prefix. Optional arguments: paired 0 = single end alignment (default); 1 = paired end. trim_sz Size to trim reads to. Default 0 (no trimming) trim_sz2 Size to trim R2 reads to for paired end alignments. Defaults to trim_sz seq_fmt Format of sequence file (fastq, bam or scarf). Default is fastq if the input file has a '.fastq' extension; scarf if it willhas be in the directory containing the fastq files. keep 1 = keep unsorted BAM (default 0, don't keep) bwa_bin BWA binary to use. Default bwa 0.7.x. Note that bwa 0.6.2 or earlier should be used for scarf and other short reads. also: NUM_THREADS, BAM_SORT_MEM, SORT_THREADS, JAVA_MEM_ARG Examples: align_bwa_illumina.sh local ABC_L001_R1.fastq.gz my_abc hg38 1 align_bwa_illumina.sh global ABC_L001_R1.fastq.gz my_abc hg38 1 50 align_bwa_illumina.sh global sequence.txt old sacCer3 0 '' '' scarf solexa |
There are lots of bells and whistles in the arguments, but the most important are the first few:
- aln_mode – whether to perform a global or local alignment (the 1st argument must be one of those words)
- global mode uses the bwa aln workflow as we did above
- local mode uses the bwa mem command
- in_file – full or relative path to the FASTQ file (just the R1 fastq if paired end). Can be compressed (.gz)
- out_pfx – prefix for all the output files produced by the script. Should relate back to what the data is.
- assembly – genome assembly to use.
- there are pre-built indexes for some common eukaryotes (hg38, hg19, mm10, mm9, danRer7, sacCer3) that you can use
- or provide a full path for a bwa reference index you have built somewhere
- paired flag – 0 means single end (the default); 1 means paired end
- trim_sz – if you want the FASTQ hard trimmed down to a specific length before alignment, supply that number here
We're going to run this script and a similar Bowtie2 alignment script, on the yeast data using the TACC batch system. In a new directory, copy over the commands and submit the batch job. We ask for 2 hours (-t 02:00:00) with 4 tasks/node (-w 4); since we have 4 commands, this will run on 1 compute node.
Expand | |||||
---|---|---|---|---|---|
| |||||
|
Code Block | ||||
---|---|---|---|---|
| ||||
# Make sure you're not in an idev session by looking at the hostname
hostname
# If the hostname looks like "c455-004.stampede2.tacc.utexas.edu", exit the idev session
# Make a new alignment directory for running these scripts
mkdir -p $SCRATCH/core_ngs/alignment/bwa_script
cd $SCRATCH/core_ngs/alignment/bwa_script
ln -s -f ../fastq
# Copy the alignment commands file and submit the batch job
cp $CORENGS/tacc/aln_script.cmds .
launcher_creator.py -j aln_script.cmds -n aln_script -t 02:00:00 -w 4 -a UT-2015-05-18 -q normal
sbatch --reservation=BIO_DATA_week_1 aln_script.slurm
showq -u |
While we're waiting for the job to complete, lets look at the aln_script.cmds file.
Code Block | ||||
---|---|---|---|---|
| ||||
/work2/projects/BioITeam/common/script/align_bwa_illumina.sh global ./fastq/Sample_Yeast_L005_R1.cat.fastq.gz bwa_global sacCer3 1 50
/work2/projects/BioITeam/common/script/align_bwa_illumina.sh local ./fastq/Sample_Yeast_L005_R1.cat.fastq.gz bwa_local sacCer3 1
/work2/projects/BioITeam/common/script/align_bowtie2_illumina.sh global ./fastq/Sample_Yeast_L005_R1.cat.fastq.gz bt2_global sacCer3 1 50
/work2/projects/BioITeam/common/script/align_bowtie2_illumina.sh local ./fastq/Sample_Yeast_L005_R1.cat.fastq.gz bt2_local sacCer3 1 |
Notes:
- The 1st command performs a paired-end BWA global alignment (similar to above), but asks that the 100 bp reads be trimmed to 50 first.
- we refer to the pre-built index for yeast by name: sacCer3
- this index is located in the /work/projects/BioITeam/ref_genome/bwa/bwtsw/sacCer3/ directory
- we provide the name of the R1 FASTQ file
- because we request a PE alignment (the 1 argument) the script will look for a similarly-named R2 file.
- all output files associated with this command will be named with the prefix bwa_global.
- we refer to the pre-built index for yeast by name: sacCer3
- The 2nd command performs a paired-end BWA local alignment.
- all output files associated with this command will be named with the prefix bwa_local.
- no trimming is requested because the local alignment should ignore 5' and 3' bases that don't match the reference genome
- The 3rd command performs a paired-end Bowtie2 global alignment.
- the Bowtie2 alignment script has the same first arguments as the BWA alignment script.
- all output files associated with this command will be named with the prefix bt2_global.
- again, we specify that reads should first be trimmed to 50 bp.
- The 4th command performs a paired-end Bowtie2 local alignment.
- all output files associated with this command will be named with the prefix bt2_local.
- again, no trimming is requested for the local alignment.
Output files
This alignment pipeline script performs the following steps:
- Hard trims FASTQ, if optionally specified (fastx_trimmer)
- Performs the global or local alignment (here, a PE alignment)
- BWA global: bwa aln the R1 and R2 separately, then bwa sampe to produce a SAM file
- BWA local: call bwa mem with both R1 and R2 to produce a SAM file
- Bowtie2 global: call bowtie2 --global with both R1 and R2 to produce a SAM file
- Bowtie2 local: call bowtie2 --local with both R1 and R2 to produce a SAM file
- BWA global: bwa aln the R1 and R2 separately, then bwa sampe to produce a SAM file
- Converts SAM to BAM (samtools view)
- Sorts the BAM (samtools sort)
- Marks duplicates (Picard MarkDuplicates)
- Indexes the sorted, duplicate-marked BAM (samtools index)
- Gathers statistics (samtools idxstats, samtools flagstat, plus a custom statistics script of Anna's)
- Removes intermediate files
There are a number of output files, with the most important being those desribed below.
- <prefix>.align.log – Log file of the entire alignment process.
- check the tail of this file to make sure the alignment was successful
- <prefix>.sort.dup.bam – Sorted, duplicate-marked alignment file.
- <prefix>.sort.dup.bam.bai – Index for the sorted, duplicate-marked alignment file
- <prefix>.flagstat.txt – samtools flagstat output
- <prefix>.idxstats.txt – samtools idxstats output
- <prefix>.samstats.txt – Summary alignment statistics from Anna's stats script
- <prefix>.iszinfo.txt – Insert size statistics (for paired-end alignments) from Anna's stats script
Verifying alignment success
The alignment log will have a "I ran successfully" message at the end if all went well, and if there was an error, the important information should also be at the end of the log file. So you can use tail to check the status of an alignment. For example:
Code Block | ||||
---|---|---|---|---|
| ||||
tail bwa_global.align.log |
This will show something like:
Code Block |
---|
..Done alignmentUtils.pl bamstats - 2020-06-14 23:19:38 .. samstats file 'bwa_global.samstats.txt' exists and is not empty - 2020-06-14 23:19:38 ===========a '.sequence.txt' extension. qual_type Type of read quality scores (sanger, illumina or solexa). Default is sanger for fastq, illumina for scarf. Environment variables: show_only 1 = only show what would be done (default not set) aln_args other bowtie2 options (e.g. '-T 20' for mem, '-l 20' for aln) no_markdup 1 = don't mark duplicates (default 0, mark duplicates) run_fastqc 1 = run fastqc (default 0, don't run). Note that output will be in the directory containing the fastq files. keep 1 = keep unsorted BAM (default 0, don't keep) bwa_bin BWA binary to use. Default bwa 0.7.x. Note that bwa 0.6.2 or earlier should be used for scarf and other short reads. also: NUM_THREADS, BAM_SORT_MEM, SORT_THREADS, JAVA_MEM_ARG Examples: align_bwa_illumina.sh local ABC_L001_R1.fastq.gz my_abc hg38 1 align_bwa_illumina.sh global ABC_L001_R1.fastq.gz my_abc hg38 1 50 align_bwa_illumina.sh global sequence.txt old sacCer3 0 '' '' scarf solexa |
There are lots of bells and whistles in the arguments, but the most important are the first few:
- aln_mode – whether to perform a global or local alignment (the 1st argument must be one of those words)
- global mode uses the bwa aln workflow as we did above
- local mode uses the bwa mem command
- in_file – full or relative path to the FASTQ file (just the R1 fastq if paired end). Can be compressed (.gz)
- out_pfx – prefix for all the output files produced by the script. Should relate back to what the data is.
- assembly – genome assembly to use.
- there are pre-built indexes for some common eukaryotes (hg38, hg19, mm10, mm9, danRer7, sacCer3) that you can use
- or provide a full path for a bwa reference index you have built somewhere
- paired flag – 0 means single end (the default); 1 means paired end
- trim_sz – if you want the FASTQ hard trimmed down to a specific length before alignment, supply that number here
We're going to run this script and a similar Bowtie2 alignment script, on the yeast data using the TACC batch system. In a new directory, copy over the commands and submit the batch job. We ask for 2 hours (-t 02:00:00) with 4 tasks/node (-w 4); since we have 4 commands, this will run on 1 compute node.
Code Block | ||||
---|---|---|---|---|
| ||||
# Make sure you're not in an idev session by looking at the hostname
hostname
# If the hostname looks like "c455-004.ls6.tacc.utexas.edu", exit the idev session
# Copy over the Yeast data if needed
mkdir -p $SCRATCH/core_ngs/alignment/fastq
cp $CORENGS/alignment/Sample_Yeast*.gz $SCRATCH/core_ngs/alignment/fastq/
# Make a new alignment directory for running these scripts
mkdir -p $SCRATCH/core_ngs/alignment/bwa_script
cd $SCRATCH/core_ngs/alignment/bwa_script
ln -sf ../fastq
# Copy the alignment commands file and submit the batch job
cd $SCRATCH/core_ngs/alignment/bwa_script
cp $CORENGS/tacc/aln_script.cmds .
# Use -a TRA23004 below if OTH21164 hasn't been working for you...
launcher_creator.py -j aln_script.cmds -n aln_script -t 01:00:00 -w 4 -a OTH21164 -q normal
sbatch --reservation=CoreNGS-Thu aln_script.slurm
# or
launcher_creator.py -j aln_script.cmds -n aln_script -t 01:00:00 -w 4 -a OTH21164 -q development
sbatch aln_script.slurm
showq -u |
While we're waiting for the job to complete, lets look at the aln_script.cmds file.
Code Block | ||||
---|---|---|---|---|
| ||||
/work/projects/BioITeam/common/script/align_bwa_illumina.sh global ./fastq/Sample_Yeast_L005_R1.cat.fastq.gz bwa_global sacCer3 1 50
/work/projects/BioITeam/common/script/align_bwa_illumina.sh local ./fastq/Sample_Yeast_L005_R1.cat.fastq.gz bwa_local sacCer3 1
/work/projects/BioITeam/common/script/align_bowtie2_illumina.sh global ./fastq/Sample_Yeast_L005_R1.cat.fastq.gz bt2_global sacCer3 1 50
/work/projects/BioITeam/common/script/align_bowtie2_illumina.sh local ./fastq/Sample_Yeast_L005_R1.cat.fastq.gz bt2_local sacCer3 1 |
Notes:
- The 1st command performs a paired-end BWA global alignment (similar to above), but asks that the 100 bp reads be trimmed to 50 first.
- we refer to the pre-built index for yeast by name: sacCer3
- this index is located in the /work/projects/BioITeam/ref_genome/bwa/bwtsw/sacCer3/ directory
- we provide the name of the R1 FASTQ file
- because we request a PE alignment (the 1 argument) the script will look for a similarly-named R2 file.
- all output files associated with this command will be named with the prefix bwa_global.
- we refer to the pre-built index for yeast by name: sacCer3
- The 2nd command performs a paired-end BWA local alignment.
- all output files associated with this command will be named with the prefix bwa_local.
- no trimming is requested because the local alignment should ignore 5' and 3' bases that don't match the reference genome
- The 3rd command performs a paired-end Bowtie2 global alignment.
- the Bowtie2 alignment script has the same first arguments as the BWA alignment script.
- all output files associated with this command will be named with the prefix bt2_global.
- again, we specify that reads should first be trimmed to 50 bp.
- The 4th command performs a paired-end Bowtie2 local alignment.
- all output files associated with this command will be named with the prefix bt2_local.
- again, no trimming is requested for the local alignment.
Output files
This alignment pipeline script performs the following steps:
- Hard trims FASTQ, if optionally specified (fastx_trimmer)
- Performs the global or local alignment (here, a PE alignment)
- BWA global: bwa aln the R1 and R2 separately, then bwa sampe to produce a SAM file
- BWA local: call bwa mem with both R1 and R2 to produce a SAM file
- Bowtie2 global: call bowtie2 in its default global (end-to-end) mode on both R1 and R2 to produce a SAM file
- Bowtie2 local: call bowtie2 --local with both R1 and R2 to produce a SAM file
- BWA global: bwa aln the R1 and R2 separately, then bwa sampe to produce a SAM file
- Converts SAM to BAM (samtools view)
- Sorts the BAM (samtools sort)
- Marks duplicates (Picard MarkDuplicates)
- Indexes the sorted, duplicate-marked BAM (samtools index)
- Gathers statistics (samtools idxstats, samtools flagstat, plus a custom statistics script of Anna's)
- Removes intermediate files
There are a number of output files, with the most important being those desribed below.
- <prefix>.align.log – Log file of the entire alignment process.
- check the tail of this file to make sure the alignment was successful
- <prefix>.sort.dup.bam – Sorted, duplicate-marked alignment file.
- <prefix>.sort.dup.bam.bai – Index for the sorted, duplicate-marked alignment file
- <prefix>.flagstat.txt – samtools flagstat output
- <prefix>.idxstats.txt – samtools idxstats output
- <prefix>.samstats.txt – Summary alignment statistics from Anna's stats script
- <prefix>.iszinfo.txt – Insert size statistics (for paired-end alignments) from Anna's stats script
Verifying alignment success
The alignment log will have a "I ran successfully" message at the end if all went well, and if there was an error, the important information should also be at the end of the log file. So you can use tail to check the status of an alignment. For example:
Code Block | ||||
---|---|---|---|---|
| ||||
tail bwa_global.align.log |
This will show something like:
Code Block |
---|
------------------------------------------------------------------ ..Done alignmentUtils.pl bamstats - 2022-06-10 12:59:05 .. samstats file 'bwa_global.samstats.txt' exists and is not empty - 2022-06-10 12:59:05 =============================================================================== ## Cleaning up files (keep 0) - 20202022-06-1410 2312:1959:3805 =============================================================================== ckRes 0 cleanup =============================================================================== ## All bwa alignment tasks completed successfully! - 20202022-06-1410 2312:1959:3806 =============================================================================== |
...
Code Block | ||
---|---|---|
| ||
----------------------------------------------- Aligner: bwa Total sequences: 1184360 Total mapped: 539079 (45.5 %) Total unmapped: 645281 (54.5 %) Primary: 539079 (100.0 %) Secondary: Duplicates: 249655 (46.3 %) Fwd strand: 267978 (49.7 %) Rev strand: 271101 (50.3 %) Unique hit: 503629 (93.4 %) Multi hit: 35450 (6.6 %) Soft clip: All match: 531746 (98.6 %) Indels: 7333 (1.4 %) Spliced: ----------------------------------------------- Total PE seqs: 1184360 PE seqs mapped: 539079 (45.5 %) Num PE pairs: 592180 F5 1st end mapped: 372121 (62.8 %) F3 2nd end mapped: 166958 (28.2 %) PE pairs mapped: 80975 (13.7 %) PE proper pairs: 16817 (2.8 %) ------------------------------------------------ |
...
- |
Since this was a paired end alignment there is paired-end specific information reported. Note that this Yeast dataset was of poor quality, especially the R2 reads. You can see this by the relatively low R1 alignment rate (~63%) and the really low R2 alignment rate (~28%).
You can also view statistics on insert sizes for properly paired reads in the bwa_global.iszinfo.txt file. This tells you the average (mean) insert size, standard deviation, mode (most common value), and fivenum values (minimum, 1st quartile, median, 3rd quartile, maximum).
...
The great thing about pipeline scripts like this is that you can perform alignments on many datasets in parallel at TACC, and they are written to take advantage of having multiple cores on TACC nodes where possible.
On the stampede2, with its 68 physical cores per node, they the ls6 the pipeline scripts are designed to run best with no more than 4 tasks per node. Although each ls6 node has 128 physical cores per node, the alignment workflow is heavily I/O bound overall, and we don't want to overload the file system.
Tip | ||
---|---|---|
| ||
These alignment scripts should always be run with a wayness of 4 (-w 4) in the stampede2 ls6 batch system, meaning at most 4 commands per node. |
Exercise #4: Bowtie2
...
alignment - Vibrio cholerae RNA-seq
While we have focused on aligning eukaryotic data, the same tools can be used with prokaryotic data. The major differences are less about the underlying data and much more about the external/public databases that store and distribute reference data. If we want to study a prokaryote, the reference data is usually downloaded from a resource like GenBank.
In this exercise, we will use some RNA-seq data from Vibrio cholerae, published on GEO here, and align it to a reference genome.
...
- Prepare the vibCho reference index for bowtie2 from GenBank records
- Align reads using bowtie2, producing a SAM file
- Convert the SAM file to a BAM file (samtools view)
- Sort the BAM file by genomic location (samtools sort)
- Index the BAM file (samtools index)
- Gather simple alignment statistics (samtools flagstat and samtools idxstatidxstats)
Obtaining the GenBank records
First prepare a directory to work infor the vibCho fasta, and change to it:
Code Block | ||
---|---|---|
| ||
mkdir -p $SCRATCH/core_ngs/references/vibChofasta cd $SCRATCH/core_ngs/references/vibChofasta |
V. cholerae has two chromosomes. We download each separately.
- Navigate to http://www.ncbi.nlm.nih.gov/nuccore/NC_012582
- click on the Send to down arrow (top right of page)
- select Complete Record
- select File as Destination, and Format FASTA
- click Create File
- in the Opening File dialog, select Save File then OK
- Save the file on your local computer as NC_012582.fa
- click on the Send to down arrow (top right of page)
- Back on the main on the main http://www.ncbi.nlm.nih.gov/nuccore/NC_012582 page
- click on the Send to down arrow (top right of page)
- select Complete Record
- select File as Destination, and Format GFF3
- click Create File
- in the Opening File dialog, select Save File then OK
- Save the file on your local computer as NC_012582.gff3
- click on the Send to down arrow (top right of page)
- Repeat steps 1 and 2 for the 2nd chromosome
- NCBI URL is http://www.ncbi.nlm.nih.gov/nuccore/NC_
- click on the Send to down arrow (top right of page)
- select Complete Record
- select File as Destination, and Format GFF3
- click Create File
- in the Opening File dialog, select Save File then OK
- Save the file on your local computer as NC_012582.gff3
- Repeat steps 1 and 2 for the 2nd chromosome
- NCBI URL is http://www.ncbi.nlm.nih.gov/nuccore/NC_012583
- use NC_012583 as the filename prefix for the files you save
- you should now have 4 files:
- NC_012582.fa, NC_012582.gff3
- NC_012583.fa, NC_012583.gff3
- Transfer the files from your local computer to TACC
- to the ~/scratch/core_ngs/references/vibCho directory created above
- On a Mac or Windows with a WSL shell, use scp from your laptop
- On Windows, use the pscp.exe PuTTy tool
- See Copying files between TACC and your laptop
- On a Mac or Windows with a WSL shell, use scp from your laptop
- to the ~/scratch/core_ngs/references/vibCho directory created above
Expand | |||||
---|---|---|---|---|---|
| |||||
|
Once you have the 4 files locally in your $SCRATCH/core_ngs/references/vibCho directory, combine them using cat:
Code Block | ||
---|---|---|
| ||
cd $SCRATCH/core_ngs/references/vibCho
cat NC_01258[23].fa > vibCho.O395.fa
cat NC_01258[23].gff3 > vibCho.O395.gff3 |
Now we have a reference sequence file that we can use with the bowtie2 reference builder, and ultimately align sequence data against.
Introducing bowtie2
First make sure you're in an idev session:
Code Block | ||||
---|---|---|---|---|
| ||||
idev -m 180 -p normal -A UT-2015-05-18 -N 1 -n 68
|
Go ahead and load the bowtie2 module so we can examine some help pages and options.
Code Block | ||
---|---|---|
| ||
module biocontainers
module load bowtie
|
Now that it's loaded, check out the options. There are a lot of them! In fact for the full range of options and their meaning, Google "Bowtie2 manual" and bring up that page (http://bowtie-bio.sourceforge.net/bowtie2/manual.shtml). The Table of Contents is several pages long! Ouch!
This is the key to using bowtie2 - it allows you to control almost everything about its behavior, which make it the go-to aligner for specialized alignment tasks (e.g. aligning miRNA or other small reads). But it also makes it is much more challenging to use than bwa – and it's easier to screw things up too!
Building the bowtie2 vibCho index
Before the alignment, of course, we've got to build a bowtie2- specific index using bowtie2-build. Go ahead and check out its options. Unlike for the aligner itself, we only need to worry about a few things here:
- reference_in file is just the vibCho.O395.fa FASTA we built from GenBank records
- bt2_index_base is the prefix of all the bowtie2-build output file
Here, to build the reference index for alignment, we only need the FASTA file. (This is not always true - extensively spliced transcriptomes requires splice junction annotations to align RNA-seq data properly.)
First create a directory specifically for the bowtie2 index, then build the index using bowtie-build.
Code Block | ||||
---|---|---|---|---|
| ||||
mkdir -p $SCRATCH/core_ngs/references/bt2/vibCho
cd $SCRATCH/core_ngs/references/bt2/vibCho
# Symlink to the fasta file you created
ln -sf $SCRATCH/core_ngs/references/vibCho.O395.fa
# or, to catch up:
ln -sf $CORENGS/references/vibCho.O395.fa
bowtie2-build vibCho.O395.fa vibCho.O395
|
This should also go pretty fast. You can see the resulting files using ls like before.
...
- 012583
- use NC_012583 as the filename prefix for the files you save
- you should now have 4 files:
- NC_012582.fa, NC_012582.gff3
- NC_012583.fa, NC_012583.gff3
- Transfer the files from your local computer to TACC
- to the ~/scratch/core_ngs/references/vibCho directory created above
- On a Mac or Windows 10 or later, use scp from your laptop
- Otherwise on Windows, use the pscp.exe PuTTy tool
- See Copying files between TACC and your laptop
- On a Mac or Windows 10 or later, use scp from your laptop
- to the ~/scratch/core_ngs/references/vibCho directory created above
Expand | |||||
---|---|---|---|---|---|
| |||||
|
Once you have the 4 files locally in your $SCRATCH/core_ngs/references/vibCho directory, combine them using cat:
Code Block | ||
---|---|---|
| ||
cd $SCRATCH/core_ngs/references/fasta
cat NC_01258[23].fa > vibCho.O395.fa
cat NC_01258[23].gff3 > vibCho.O395.gff3
# verify there are 2 contigs in vibCho.O395.fa
grep -P '^>' vibCho.O395.fa |
Now we have a reference sequence file that we can use with the bowtie2 reference builder, and ultimately align sequence data against.
Introducing bowtie2
First make sure you're in an idev session:
Code Block | ||||
---|---|---|---|---|
| ||||
idev -m 120 -A OTH21164 -N 1 -r CoreNGS # or -A TRA23004
# or
idev -m 90 -A OTH21164 -N 1 -p development # or -A TRA23004 |
Go ahead and load the bowtie2 module so we can examine some help pages and options.
Code Block | ||
---|---|---|
| ||
module load biocontainers
module load bowtie2
|
Now that it's loaded, check out the options. There are a lot of them! In fact for the full range of options and their meaning, Google "Bowtie2 manual" and bring up that page (http://bowtie-bio.sourceforge.net/bowtie2/manual.shtml). The Table of Contents is several pages long! Ouch!
This is the key to using bowtie2 - it allows you to control almost everything about its behavior, which make it the go-to aligner for specialized alignment tasks (e.g. aligning miRNA or other small reads). But it also makes it is much more challenging to use than bwa – and it's easier to screw things up too!
Building the bowtie2 vibCho index
Before the alignment, of course, we've got to build a bowtie2- specific index using bowtie2-build. Go ahead and check out its options. Unlike for the aligner itself, we only need to worry about a few things here:
- reference_in file is just the vibCho.O395.fa FASTA we built from GenBank records
- bt2_index_base is the prefix of all the bowtie2-build output file
Here, to build the reference index for alignment, we only need the FASTA file. (This is not always true - extensively spliced transcriptomes requires splice junction annotations to align RNA-seq data properly.)
First create a directory specifically for the bowtie2 index, then build the index using bowtie-build.
Expand | |||||
---|---|---|---|---|---|
| |||||
|
Code Block | ||||
---|---|---|---|---|
| ||||
mkdir -p $SCRATCH/core_ngs/references/bt2/vibCho
cd $SCRATCH/core_ngs/references/bt2/vibCho
# Symlink to the fasta file you created using relative path syntax
ln -sf ../../fasta/vibCho.O395.fa
bowtie2-build vibCho.O395.fa vibCho.O395
|
This should also go pretty fast. You can see the resulting files using ls like before.
Performing the bowtie2 alignment
Make sure you're in an idev session with the bowtie2 BioContainers module loaded:
Code Block | ||
---|---|---|
| ||
idev -m 120 -A OTH21164 -N 1 -r CoreNGS # or -A TRA23004
# or
idev -m 90 -A OTH21164 -N 1 -p development # or -A TRA23004
module load biocontainers
module load bowtie2 |
We'll set up a new directory to perform the V. cholerae data alignment. But first make sure you have the FASTQ file to align and the vibCho bowtie2 index:.
Code Block | ||
---|---|---|
| ||
# Get the FASTQ to align mkdir -p $SCRATCH/core_ngs/alignment/fastq cp $CORENGS/alignment/*fastq.gz $SCRATCH/core_ngs/alignment/fastq/ # Set up the bowtie2 index# Get a pre-built vibCho index if you didn't already build one mkdir -p $SCRATCH/core_ngs/references/bt2/vibCho cp $CORENGS/idxreferences/bt2/vibCho/*.* $SCRATCH/core_ngs/references/bt2/vibCho |
Make sure you're in an idev session with the bowtie2 BioContainers module loaded:
Code Block | ||
---|---|---|
| ||
idev -p normal -m 120 -A UT-2015-05-18 -N 1 -n 68 module load biocontainers module load bowtie/ # Get the FASTQ to align mkdir -p $SCRATCH/core_ngs/alignment/fastq cp $CORENGS/alignment/*fastq.gz $SCRATCH/core_ngs/alignment/fastq/ |
Now set up a directlry directory to do this alignment, with symbolic links to the bowtie2 index directory and the directory containing the FASTQ to align:
...
We'll be aligning the V. cholerae reads now in ./fq/cholera_rnaseq.fastq.gz (how many sequences does it contain?)
...
As you can tell from looking at the bowtie2 help message, the general syntax looks like this:
Code Block |
---|
bowtie2 [options]* -x <bt2-idx> {-1 <m1> -2 <m2> | -U <r>} [-S <sam>] |
So execute this bowtie2 global, single-end alignment command:
Code Block | ||
---|---|---|
| ||
cd $SCRATCH/core_ngs/alignment/vibCho
bowtie2 -x vibCho/vibCho.O395 -U fq/cholera_rnaseq.fastq.gz -S cholera_rnaseq.sam 2>&1 | tee aln_global.log |
Notes:
- -x vibCho/vibCho.O395.fa – prefix path of index files
- -U fq/cholera_rnaseq.fastq.gz – FASTQ file for single-end (Unpaired) alignment
- -S cholera_rnaseq.sam – tells bowtie2 to report alignments in SAM format to the specified file
- 2>&1 redirects standard error to standard output
- while the alignment data is being written to the cholera_rnaseq.sam file, bowtie2 will report its progress to standard error.
- | tee aln.log takes the bowtie2 progress output and pipes it to the tee program
- tee takes its standard input and writes it to the specified file and also to standard output
- that way, you can see the progress output now, but also save it to review later (or supply to MultiQC)
Since the FASTQ file is not large, this should not take too long, and you will see progress output like this:
Code Block |
---|
89006 reads; of these:
89006 (100.00%) were unpaired; of these:
20675 (23.23%) aligned 0 times
38226 (42.95%) aligned exactly 1 time
30105 (33.82%) aligned >1 times
76.77% overall alignment rate |
When the job is complete you should have a cholera_rnaseq.sam file that you can examine using whatever commands you like. Remember, to further process it downstream, you should create a sorted, indexed BAM file from this SAM output.
Exercise: Repeat the alignment performing a local alignment, and write the output in BAM format. How do the alignment statistics compare?
Expand | ||
---|---|---|
| ||
--local |
...
title | Answer |
---|
Code Block | ||
---|---|---|
| ||
module load samtools
cd $SCRATCH/core_ngs/alignment/vibCho
bowtie2 --local -x vibCho/vibCho.O395 -U fq/cholera_rnaseq.fastq.gz 2>aln_local.log | \
samtools view -b > cholera_rnaseq.local.bam |
...
at the bowtie2 help message, the general syntax looks like this:
Code Block |
---|
bowtie2 [options]* -x <bt2-idx> {-1 <m1> -2 <m2> | -U <r>} [-S <sam>] |
So execute this bowtie2 global, single-end alignment command:
Expand | |||||
---|---|---|---|---|---|
| |||||
|
Code Block | ||
---|---|---|
| ||
cd $SCRATCH/core_ngs/alignment/vibCho
bowtie2 -x vibCho/vibCho.O395 -U fq/cholera_rnaseq.fastq.gz \
-S cholera_rnaseq.sam 2>&1 | tee aln_global.log |
Notes:
- -x vibCho/vibCho.O395.fa – prefix path of index files
- -U fq/cholera_rnaseq.fastq.gz – FASTQ file for single-end (Unpaired) alignment
- -S cholera_rnaseq.sam – tells bowtie2 to report alignments in SAM format to the specified file
- 2>&1 redirects standard error to standard output
- while the alignment data is being written to the cholera_rnaseq.sam file, bowtie2 will report its progress to standard error.
- | tee aln.log takes the bowtie2 progress output and pipes it to the tee program
- tee takes its standard input and writes it to the specified file and also to standard output
- that way, you can see the progress output now, but also save it to review later (or supply to MultiQC)
Since the FASTQ file is not large, this should not take too long, and you will see progress output like this:
Code Block |
---|
89006 reads; of these:
89006 (100.00%) were unpaired; of these:
270615902 (30 6.40% 63%) aligned 0 times33828 51483 (38 57.01% 84%) aligned exactly 1 time28117 31621 (31 35.59% 53%) aligned >1 times69 93.60% 37% overall alignmentrate Interestingly, the local alignment rate here is lower than we saw with the gloabl alignment. |
Exercise #5: BWA-MEM - Human mRNA-seq
After bowtie2 came out with a local alignment option, it wasn't long before bwa developed its own local alignment algorithm called BWA-MEM (for Maximal Exact Matches), implemented by the bwa mem command. bwa mem has the following advantages:
- It incorporates a lot of the simplicity of using bwa with the complexities of local alignment, enabling straightforward alignment of datasets like the mirbase data we just examined
- It can align different portions of a read to different locations on the genome
- In a total RNA-seq experiment, reads will (at some frequency) span a splice junction themselves
- or a pair of reads in a paired-end library will fall on either side of a splice junction.
- We want to be able to align these splice-adjacent reads for many reasons, from accurate transcript quantification to novel fusion transcript discovery.
- In a total RNA-seq experiment, reads will (at some frequency) span a splice junction themselves
Thus, our last exercise will be the alignment of a human total RNA-seq dataset composed (by design) almost exclusively of reads that cross splice junctions.
bwa mem was is made available by loading the bwa BioContainers module
we loaded the bwa module, so take a look at its usage information. The most important parameters, similar to those we've manipulated in the past two sections, are the following:
...
There are many more parameters to control the scoring scheme and other details, but these are the most essential ones to use to get anything of value at all.
The test file we will be working with is just the R1 file from a paired-end total RNA-seq experiment, meaning it is (for our purposes) single-end. Go ahead and take a look at it, and find out how many reads are in the file.
Expand | |||||
---|---|---|---|---|---|
| |||||
|
A word about real splice-aware aligners
Using BWA mem for RNA-seq alignment is sort of a "poor man's" RNA-seq alignment method. Real splice-aware aligners like tophat2 or star have more complex algorithms (as shown below) – and take a lot more time!
RNA-seq alignment with bwa aln
Now, try aligning it with bwa aln like we did in Example #1, but first link to the hg19 bwa index directory. In this case, due to the size of the hg19 index, we are linking to Anna's scratch area INSTEAD of our own work area containing indexes that we built ourselves.
Code Block | ||||
---|---|---|---|---|
| ||||
cd $SCRATCH/core_ngs/alignment
ln -s -f /scratch/01063/abattenh/ref_genome/bwa/bwtsw/hg19
ls hg19 |
You should see a set of files analogous to the yeast files we created earlier, except that their universal prefix is hg19.fa.
Go ahead and try to do a single-end alignment of the file to the human genome using bwa aln like we did in Exercise #1, saving intermediate files with the prefix human_rnaseq_bwa. Go ahead and just execute on the command line.
Code Block | ||||
---|---|---|---|---|
| ||||
bwa aln hg19/hg19.fa fastq/human_rnaseq.fastq.gz > human_rnaseq_bwa.sai
bwa samse hg19/hg19.fa human_rnaseq_bwa.sai fastq/human_rnaseq.fastq.gz > human_rnaseq_bwa.sam |
Once this is complete use less to take a look at the contents of the SAM file, using the space bar to leaf through them. You'll notice a lot of alignments look basically like this:
Code Block |
---|
HWI-ST1097:228:C21WMACXX:8:1316:10989:88190 4 * 0 0 * * 0 0
AAATTGCTTCCTGTCCTCATCCTTCCTGTCAGCCATCTTCCTTCGTTTGATCTCAGGGAAGTTCAGGTCTTCCAGCCGCTCTTTGCCACTGATCTCCAGCT
CCCFFFFFHHHHHIJJJJIJJJJIJJJJHJJJJJJJJJJJJJJIIIJJJIGHHIJIJIJIJHBHIJJIIHIEGHIIHGFFDDEEEDDCDDD@CDEDDDCDD |
Notice that the contig name (field 3) is just an asterisk ( * ) and the alignment flags value is a 4 (field 2), meaning the read did not align (decimal 4 = hex 0x4 = read did not map).
Essentially, nothing (with a few exceptions) aligned. Why?
Expand | ||
---|---|---|
| ||
Because this file was generated exclusively from reads in a larger dataset that cross at least one splice junction. The sequences as they exists in most of the reads do not correspond to a single location in the genome. However subsections of each read do exist somewhere in the genome. So, we need an aligner that is capable aligning different parts of the read to different genomic loci. |
RNA-seq alignment with bwa mem
Exercise: use bwa mem to align the same data
Based on the following syntax and the above reference path, use bwa mem to align the same file, saving output files with the prefix human_rnaseq_mem. Go ahead and just execute on the command line.
Code Block |
---|
bwa mem <ref.fa> <reads.fq> > outfile.sam |
Expand | |||||
---|---|---|---|---|---|
| |||||
|
Check the length of the SAM file you generated with wc -l. Since there is one alignment per line, there must be 586266 alignments (minus no more than 100 header lines), which is more than the number of sequences in the FASTQ file. This is bwa mem can report multiple alignment records for the same read, hopefully on either side of a splice junction. These alignments can still be tied together because they have the same read ID.
Expand | |||||
---|---|---|---|---|---|
| |||||
To get an idea of how often each read aligned, and what the 'real' alignment rate is, use the following commands:
This alignment rate is pretty good, but it could get better by playing around with the finer details of bwa mem. |
Tip |
---|
Be aware that some downstream tools (for example the Picard suite, often used before SNP calling) do not like it when a read name appears more than once in the SAM file. To mark the extra alignment records as secondary, specify the bwa mem -M option. This option leaves the best (longest) alignment for a read as -is but marks additional alignments for the read as secondary (the 0x100 BAM flag). This designation also allows you to easily filter the secondary reads with samtools if desired. |
BWA-MEM vs Tophat
Another approach to aligning long RNA-seq data is to use an aligner that is more explicitly concerned with sensitivity to splice sites, namely a program like Tophat. Tophat uses either bowtie (tophat) or bowtie2 (tophat2) as the actual aligner, but performs the following steps:
- aligns reads to the genome
- reads that do not align to the genome are aligned against a transcriptome, if provided
- if they align, the transcriptome coordinates are converted back to genomic coordinates, with gaps represented in the CIGAR string, for example as 196N
- reads that do not align to the transcriptome are split into smaller pieces, each of which Tophat attempts to map to the genome
Note that Tophat also reports secondary alignments, but they have a different meaning. Tophat always reports spliced alignments as one alignment records with the N CIGAR string operator indicating the gaps. Secondary alignments for Tophat (marked with the 0x100 BAM flag) represent alternate places in the genome where a read (spliced or not) may have mapped.
...
rate |
When the job is complete you should have a cholera_rnaseq.sam file that you can examine using whatever commands you like. Remember, to further process it downstream, you should create a sorted, indexed BAM file from this SAM output.
Exercise: Repeat the alignment performing a local alignment, and write the output in BAM format. How do the alignment statistics compare?
Expand | ||
---|---|---|
| ||
--local |
Expand | |||||||
---|---|---|---|---|---|---|---|
| |||||||
Reports these alignment statistics:
Interestingly, the local alignment rate here is lower than we saw with the global alignment. Usually local alignments have higher alignment rates than corresponding global ones. |
Exercise #5: BWA-MEM - Human mRNA-seq
After bowtie2 came out with a local alignment option, it wasn't long before bwa developed its own local alignment algorithm called BWA-MEM (for Maximal Exact Matches), implemented by the bwa mem command.
bwa mem has the following advantages:
- It provides the simplicity of using bwa without the complexities of local alignment
- It can align different portions of a read to different locations on the genome
- In a total RNA-seq experiment, reads will (at some frequency) span a splice junction themselves
- or a pair of reads in a paired-end library will fall on either side of a splice junction.
- We want to be able to align these splice-adjacent reads for many reasons, from accurate transcript quantification to novel fusion transcript discovery.
- In a total RNA-seq experiment, reads will (at some frequency) span a splice junction themselves
This exercise will align a human total RNA-seq dataset that includes numerous reads that cross splice junctions.
A word about real splice-aware aligners
Using bwa mem for RNA-seq alignment is sort of a "poor man's" RNA-seq alignment method. Real splice-aware aligners like STAR, hisat2 or tophat have more complex algorithms (as shown below) – and take a lot more time!
In the transcriptome-aware alignment above, reads that span splice junctions are reported in the SAM file with genomic coordinates that start in the first exon and end in the second exon (the CIGAR string uses the N operator, e.g. 30M1000N60M).
BWA MEM does not know about the exon structure of the genome. But it can align different sub-sections of a read to two different locations, producing two alignment records from one input read. One of the two will be marked as secondary (0x100 flag).
BWA MEM splits junction-spanning reads into two alignment records |
---|
Setup for BWA mem
First set up our working directory for this alignment. Since it takes a long time to build a bwa index for a large genome (here human hg38/GRCh38), we'll use one that the BioITeam maintains in its /work/projects/BioITeam/ref_genome area.
Code Block | ||||
---|---|---|---|---|
| ||||
# Make sure you're in an idev session
idev -m 120 -N 1 -A OTH21164 -r CoreNGS # or -A TRA23004
# or
idev -m 90 -N 1 -A OTH21164 -p development # or -A TRA23004
# Load the modules we'll need
module load biocontainers
module load bwa
module load samtools
# Copy over the FASTQ data if needed
mkdir -p $SCRATCH/core_ngs/alignment/fastq
cp $CORENGS/alignment/*.gz $SCRATCH/core_ngs/alignment/fastq/
# Make a new alignment directory for running these scripts
cds
mkdir -p core_ngs/alignment/bwamem
cd core_ngs/alignment/bwamem
ln -sf ../fastq
ln -sf /work/projects/BioITeam/ref_genome/bwa/bwtsw/hg38
|
Now take a look at bwa mem usage (type bwa mem with no arguments, or bwa mem 2>&1 | more). The most important parameters are the following:
Option | Effect |
---|---|
-k | Controls the minimum seed length (default = 19) |
-w | Controls the "gap bandwidth", or the length of a maximum gap. This is particularly relevant for MEM, since it can determine whether a read is split into two separate alignments or is reported as one long alignment with a long gap in the middle (default = 100) |
-M | For split reads, mark the shorter read as secondary |
-r | Controls how long an alignment must be relative to its seed before it is re-seeded to try to find a best-fit local match (default = 1.5, e.g. the value of -k multiplied by 1.5) |
-c | Controls how many matches a MEM must have in the genome before it is discarded (default = 10000) |
-t | Controls the number of threads to use |
RNA-seq alignment with bwa mem
Based on its help info, this is the structure of the bwa mem command we will use:
Code Block |
---|
bwa mem -M <ref.fa> <reads.fq> > outfile.sam |
After performing the setup above, execute the following command in your idev session:
Code Block | ||
---|---|---|
| ||
cd $SCRATCH/core_ngs/alignment/bwamem
bwa mem -M hg38/hg38.fa fastq/human_rnaseq.fastq.gz 2>hs_rna.bwamem.log | \
samtools view -b | \
samtools sort -O BAM -T human_rnaseq.tmp > human_rnaseq.sort.bam |
This multi-pipe command performs three steps:
- The bwa mem alignment
- the program's progress output (on standard error) is redirected to a log file (2>hs_rna.bwamem.log)
- its alignment records (on standard output) is piped to the next step (conversion to BAM)
- Conversion of bwa mem's SAM output to BAM format
- recall that the -b option to samtools view says to output in BAM format
- Sorting the BAM file
- samtools sort takes the binary output from samtools view and writes a sorted BAM file.
Because the progress output is being redirected to a log file, we won't see anything until the command completes. Then you should have a human_rnaseq.sort.bam file and an hs_rna.bwamem.log logfile.
Exercise: Compare the number of original FASTQ reads to the number of alignment records.
Expand | ||
---|---|---|
| ||
Use the zcat | wc -l | awk idiom to count FASTQ reads. Use samtools flagstat to report alignment statistics. |
Expand | ||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
| ||||||||||||
Count the FASTQ file reads:
The file has 100,000 reads. Generate alignment statistics from the sorted BAM file:
Output will look like this:
There were 133,570 alignment records reported for the 100,000 input reads. Because bwa mem can split reads and report two alignment records for the same read, there are 33,570 secondary reads reported here. |
Tip |
---|
Be aware that some downstream tools (for example the Picard suite, often used before SNP calling) do not like it when a read name appears more than once in the SAM file. Such reads can be filtered, but only if they can be identified as secondary by specifying the bwa mem -M option as we did above. This option reports the longest alignment normally but marks additional alignments for the read as secondary (the 0x100 BAM flag). This designation also allows you to easily filter out the secondary reads with samtools view -F 0x104 if desired. |