Skip to end of metadata
Go to start of metadata

You are viewing an old version of this page. View the current version.

Compare with Current View Page History

« Previous Version 5 Next »

Overview

Before you start the alignment and analysis processes, it can be useful to perform some initial quality checks on your raw data. If you don't do this (or even if you do), you may notice later that something looks fishy in the the output: for example, many of your reads are not mapping or the ends of many of your reads do not align. Both can give you clues about whether you need to process the reads to improve the quality of data that you are putting into your analysis. Each year this tutorial is discussed at some length for if it should be included as a main tutorial, if it should be included as an optional tutorial, or if it should be ignored all together as the quality of data increases. Recently a colleague of ours spent several days working with and trying to understand some data he got back before reaching out for help, after a few hours of running into a wall, fastqc was used to determine that the library was not constructed correctly in less than 30 minutes. So here we present the tutorial as quick thing to check which may save you significant amounts of time later on. 

Learning Objectives

This tutorial covers the commands necessary to use several common programs for evaluating read files in FASTQ format and for processing them (if necessary).

  • Diagnose common issues in FASTQ read files that will negatively impact analysis.
  • Trim adaptor sequences and low quality regions from the ends of reads to improve analysis.

Table of Contents

As we discussed yesterday, we do not want to run things on the head node, so we should start a new idev session. The reservation name has changed from CCBB_Bio_Summer_School_2016_Day1 to CCBB_Bio_Summer_School_2016_Day2. See if you can figure out how to start your own idev session.

click here for idev command solution
idev  -m 240 -r CCBB_Bio_Summer_School_2016_Day2 -A UT-2015-05-18 -N 2 -n 8

Illumina sequence data format (FASTQ)

GSAF gives you paired end sequencing data in two matching FASTQ format files, containing reads for each end sequenced: for example, Sample_ABC_L005_R1.cat.fastq and Sample_ABC_L005_R2.cat.fastq. Each read end sequenced is representd by a 4-line entry in the FASTQ file.

A 4-line FASTQ file entry looks like this:

A four-line FASTQ file entry representing one sequence
@HWI-ST1097:104:D13TNACXX:4:1101:1715:2142 1:N:0:CGATGT
GCGTTGGTGGCATAGTGGTGAGCATAGCTGCCTTCCAAGCAGTTATGGGAG
+
=<@BDDD=A;+2C9F<CB?;CGGA<<ACEE*1?C:D>DE=FC*0BAG?DB6
  1. Line 1 is the read identifier, which describes the machine, flowcell, cluster, grid coordinate, end and barcode for the read. Except for the barcode information, read identifiers will be identical for corresponding entries in the R1 and R2 fastq files.
  2. Line 2 is the sequence reported by the machine.
  3. Line 3 is always '+' from GSAF (it can optionally include a sequence description but rarely or never actually does)
  4. Line 4 is a string of Ascii-encoded base quality scores, one character per base in the sequence. For each base, an integer quality score = -10 log(probabilty base is wrong) is calculated, then added to 33 to make a number in the ASCII printable character range.

See the Wikipedia FASTQ format page for more information.

 

Now that you know the basics, see if you can complete the following exercises on your own.

Exercise: Examine the 2nd sequence in a FASTQ file

What the 2nd sequence in the file $BI/gva_course/mapping/data/SRR030257_1.fastq is?

 Stuck? click here for a hint

Use the head command.

Still stuck? Click here for the full Head command
head $BI/gva_course/mapping/data/SRR030257_1.fastq 
 Answer

The 2nd sequence has ID = @SRR030257.2 HWI-EAS_4_PE-FC20GCB:6:1:407:767/1, and the sequence TAAGCCAGTCGCCATGGAATATCTGCTTTATTTAGC

If thats what you thought it was congratulations, if it is different, do you see where we got it from? If it doesn't make sense ask for help.

Counting sequences

If you get an error from running a program, one of the first thing to check is that the length of your FASTQ files is evenly divisible by four and — if the program expects paired reads — that the R1 and R2 files have the same number of reads. The wc command (word count) using the -l switch to tell it to count lines, not words, is perfect for this:

Using wc -l to count lines
wc -l $BI/gva_course/mapping/data/SRR030257_1.fastq 

Exercise: Counting FASTQ file lines

How many sequences are in the FASTQ file above?

 Answer

The wc -l command says there are 15200720 lines. FASTQ files have 4 lines per sequence, so the file has 15,200,720/4 or 3,800,180 sequences.

As mentioned many programs have problems if R1 and R2 do not have the same number of reads. While you can obviously change the wc -l command to check R2 rather than R1, fastq files are often stored in a compressed state to save disk space. By using pipes to link commands, you can still count the lines, and you don't have to uncompress the file to do it! Specifically, you can use gunzip -c to write decompressed data to standard output (-c means "to console", and leaves the original *.gz file untouched). You then pipe that output to wc -l to get the line count. 

Using wc -l on a compressed file
gunzip -c $BI/gva_course/mapping/data/SRR030257_2.fastq.gz | wc -l

How many lines/sequences does the compressed file contain? Does this agree with what you found for R1?

 How do I do math on the command line?

The bash shell has a really strange syntax for arithmetic: it uses a double-parenthesis operator. Additionally unlike a calculator that automatically prints the result to the screen when it performs an operation, we have to explicitly tell bash that we want to see what the result is. We do this using the echo command, and assigning the result to a non-named temporary variable.

Arithmetic in Bash
echo $((15200720 / 4))

While checking the number of reads a file has can solve some of the most basic problems, it doesn't really provide any direct evidence as to the quality of the sequencing data. To get this type of information before starting meaningful analysis other programs must be used. Place your sticky note on your computer when you have made it this far and start looking over the fastqc links below. Once everyone has caught up we will go over this together.

FASTQ Evaluation Tools

The first order of business after receiving sequencing data should be to check your data quality. This often-overlooked step helps guide the manner in which you process the data, and can prevent many headaches that could require you to redo an entire analysis after they rear their ugly heads.

FastQC

FastQC is a tool that produces a quality analysis report on FASTQ files. Online documentation for FastQC 

First and foremost, the FastQC "Summary" on the left should generally be ignored. Its "grading scale" (green - good, yellow - warning, red - failed) incorporates assumptions for a particular kind of experiment, and is not applicable to most real-world data. Instead, look through the individual reports and evaluate them according to your experiment type.

The FastQC reports I find most useful are:

  1. The Per base sequence quality report, which can help you decide if sequence trimming is needed before alignment.
  2. The Sequence Duplication Levels report, which helps you evaluate library enrichment / complexity. But note that different experiment types are expected to have vastly different duplication profiles.
  3. The Overrepresented Sequences report, which helps evaluate adapter contamination.
 A couple of other things to note about FastQC
  • For many of its reports, FastQC analyzes only the first 200,000 sequences in order to keep processing and memory requirements down.
  • Some of FastQC's graphs have a 1-100 vertical scale that is tricky to interpret. The 100 is a relative marker for the rest of the graph. For example, sequence duplication levels are relative to the number of unique sequences,

Running FastQC

FastQC is available from the TACC module system on lonestar. Interactive GUI versions are also available for Windows and Macintosh and can be downloaded from the Babraham Bioinformatics web site. We don't want to clutter up our work space so copy the SRR030257_1.fastq file to a new directory named BDIB_fastqc_tutorial on scratch, use the module system to load fastqc, use fastqc's help option after the module is loaded to figure out how to run the program. Once the program is completed use scp to copy the important file back to your local machine (The bold words are key words that may give you a hint of what steps to take next)

Running FastQC example
mkdir $SCRATCH/BDIB_fastqc_tutorial
cd $SCRATCH/BDIB_fastqc_tutorial
cp $BI/gva_course/mapping/data/SRR030257_1.fastq .
module load fastqc
 
fastqc -h  # examine program options
fastqc SRR030257_1.fastq  # run the program

Exercise: FastQC results

What did FastQC create?

 Answer
ls -l shows something like this
-rwxr-xr-x 1 ded G-802740 498588268 May 23 12:06 SRR030257_1.fastq
-rw-r--r-- 1 ded G-802740    291714 May 23 12:07 SRR030257_1_fastqc.html
-rw-r--r-- 1 ded G-802740    455677 May 23 12:07 SRR030257_1_fastqc.zip

The SRR030257_1.fastq file is what we analyzed, so FastQC created the other two items. SRR030257_1_fastqc.html represents the results in a file viewable in a web browser. SRR030257_1_fastqc.zip is just a Zipped (compressed) version of the results.

Looking at FastQC output

You can't run a web browser directly from your command line environment. You should copy the results back to your local machine (via scp) to open them in a web browser.

Transferring fastqc data back to computer
# on tacc terminal
pwd
 
# on new terminal of local computer
scp <username>@ls5.tacc.utexas.edu:<pwd_results_from_other_window>/SRR030257_1_fastqc.html ~/Desktop
 
# open the newly transfered file from from the desktop and see how the data looks


Exercise: Should we trim this data?

Based on this FastQC output, should we trim (1) adaptor sequences from the ends of the reads AND/OR (2) low quality regions from the ends of the reads?

 Answer

The Per base sequence quality report does not look great, but more importantly, nearly 1.5% of all the sequences are all A's according to the Overrepresented sequences. This is something that often comes up in miseq data that has shorter insert sizes than the overall read length. Next we'll start looking at how to trim our data before continuing.

FASTQ Processing Tools

FASTX Toolkit

The FASTX-Toolkit provides a set of command line tools for manipulating fasta and fastq files. The available modules are described on their website. They include a fast fastx_trimmer utility for trimming fastq sequences (and quality score strings) before alignment and fastx_clipper for trimming specific sequences (such as adapters).

FASTX-Toolkit is available via the TACC module system.

FASTX_toolkit module description
module spider fastx_toolkit
module load fastx_toolkit

Trimming low quality bases

Low quality base reads from the sequencer can cause an otherwise mappable sequence not to align. There are a number of open source tools that can trim off 3' bases and produce a FASTQ file of the trimmed reads to use as input to the alignment program, but  fastx_trimmer has the advantage of being a module on TACC and therefore the easiest to use. By default the program reads its input data from standard input and writes trimmed sequences to standard output, use what you know about piping and printing text to the screen to trip the fastq file to 34 bases.

 Hint

Type fastx_trimmer -h to see program documentation.

Look below the possible solution for more detailed information of what to focus on

One possible solution
cat SRR030257_1.fastq | fastx_trimmer -l 34 > SRR030257_1.trimmed.fastq
  • The cat command prints the contents of the SRR030257_1.fastq file to the screen
  • The | redirects that output to the fastx_trimmer command
  • The -l 34 option says that base 34 should be the last base (i.e., trim down to 34 bases)
  • The > redirects that output to the new file on the right side, in this case SRR030257_1.trimmed.fastq

Exercise: compressing the fastx_trimmer output

Compressed files are smaller, easier to transfer, and many programs allow for their use directly. How would you tell fastx_trimmer to compress (gzip) its output file?

 Hint

Type fastx_trimmer -h to see program documentation

Possible solution using the -z option
cat SRR030257_1.fastq | fastx_trimmer -l 34 -Q 30 -z > SRR030257_1.trimmed.fastq.gz
Possible solution using gzip yourself
cat SRR030257_1.fastq | fastx_trimmer -l 34 -Q 30 | gzip > SRR030257_1.trimmed.fastq.gz

Both of the above solutions give the same final product, but are clearly achieved in different ways. This is done to show you that data analysis is a results driven process, if the result is correct, and you know how you got the result it is correct as long as it is reproducable.

Adapter trimming

 As mentioned above, fastx_clipper can be used to trim specific sequences, and based on our fastqc analysis, the sequence AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA is significantly overrepresented in our data. How would you use fastx_clipper to remove those sequences from the fastq file?

 

 Hint

Type fastx_clipper -h to see program documentation

Look below the possible solution for more detailed information on what to focus on.

Possible solution
fastx_clipper -i SRR030257_1.trimmed.fastq -o SRR030257_1.trimmed.depleted.fastq -a AAAAAAAAAAAAAAAAAAAA -l 34 -n 

 

Command portionpurpose
-i SRR030257_1.trimmed.fastquse this file as input
-o SRR030257_1.trimmed.depleted.fastqcreate this new output file

-a AAAAAAAAAAAAAAAAA

remove bases containing this sequence
-l 34discard any read shorter than 34 bases after sequence removed
-nkeep reads containing "N" bases in them. Consider how they are treated in downstream applications

 

Other fastx toolkit programs

What other fastx and fastq manipulation programs are part of the fastx toolkit? The available modules are described on their website, but we can also learn some things from the command prompt using module spider fastx_toolkit.

 Hint

Type fast then tab twice to see their names
See all the programs like this:

fastx toolkit programs
ls $TACC_FASTX_BIN

Consider how you might use fastq_quality_filter and fastq_quality_trimmer to limit your data based on quality scores.

 

Return to GVA2016 course page

  • No labels