...
The cutadapt adapter trimming command reads NGS sequences from a FASTQ file, and writes adapter-trimmed reads to a FASTQ file. Find its usage.
| Expand |
|---|
|
cutadapt # overview; tells you to run cutadapt --help for details
cutadapt --help | less
cutadapt --help | more
Note that it also points you to https://cutadapt.readthedocs.io/ for full documentation. Usage:
cutadapt -a ADAPTER [options] [-o output.fastq] input.fastq |
Where does cutadapt write its output to from by default? How can that be changed?
| Expand |
|---|
|
The cutadapt usage says that output can be written to a file using the -o option Usage:
cutadapt -a ADAPTER [options] [-o output.fastq] input.fastq
But the The brackets around [-o output.fastq] suggest this is optional. Reading a bit further we see: ... Without the -o option, output is sent to standard output.
This suggests output can be specified in 2 ways: - to a file, using the -o option
- cutadapt -a CGTAATTCGCG -o trimmed.fastq small.fq
- to standard output without the -o option
- cutadapt -a CGTAATTCGCG small.fq 1> trimmed.fastq
|
...
| Expand |
|---|
|
The cutadapt usage says an input.fastq file is a required argument: cutadapt -a ADAPTER [options] [-o output.fastq] input.fastq
But again, reading a bit further we see: ... Compressed input and output is supported and
auto-detected from the file name (.gz, .xz, .bz2). Use the file name '-' for
standard input/output. ...
This suggests input can be specified in 2 ways: - from a file, using the -o option
- cutadapt -a CGTAATTCGCG -o trimmed.fastq small.fq
- from standard input if the input.fastq argument is replaced with a dash ( - )
- cat small.fq | cutadapt -a CGTAATTCGCG -o trimmed.fastq -
And also says that the input.fastq file can be provided in one of three compression formats. |
...
| Expand |
|---|
|
The cutadapt usage doesn't say anything about diagnostics: cutadapt -a ADAPTER [options] [-o output.fastq] input.fastq
But again, reading in the Output: options section: -o FILE, --output=FILE
Write trimmed reads to FILE. FASTQ or FASTA format is
chosen depending on input. The summary report is sent
to standard output. Use '{name}' in FILE to
demultiplex reads into multiple files. Default: write
to standard output
Careful reading of this suggests that: - When the trimmed output is sent to a file with the -o output.fastq option ,diagnostics are is omitted, and output goes to standard output,
- diagnostics must be written to standard outputerror
- so can be redirected to a log file with 1> 2> trim.log
- cutadapt -a CGTAATTCGCG -o trimmed.fastq small.fq 1> trimmed.fastq 2> trim.log
- But when the trimmed output is sent to a file with the -o output.fastq option is omitted, and output goes to standard output,
- diagnostics must be are written to standard erroroutput
- so can be redirected to a log file with 2> 1> trim.log
- cutadapt -a CGTAATTCGCG -o trimmed.fastq small.fq 1> trimmed.fastq 2> trim.log
|
| Expand |
|---|
|
| Code Block |
|---|
| cd ~/gzips
cutadapt -a AGATCGGAAGAGCACACGTCTGA small.fq > trimmed.fq |
|