Part 2: Working with files

Files and File systems

Working with remote files

scp (secure copy)

The cp command only copies files/directories with the local host's file systems. The scp command is similar to cp, but scp lets you securely copy files from one machine to another. And also like cp, scp has a -r (recursive) option to copy directories.

scp usage is similar to cp in that it copies from a <source> to a <destination>, but uses remote machine addressing to qualify either the <source> or the <destination> but not both.

Remote machine addressing looks like this: <user_account>@<hostname>:<source_or_destination>

Examples:

Open a new Terminal (Mac) or Command Prompt (Window) window on your local computer (not logged in to your student account), and try the following, using your studentNN account and GSAF pod host. (This example will not work if you're using the RStudio Terminal because you don't have access to the UT VPN service.)

Note that you will always be prompted for your credentials on the remote host when you execute an scp command.

To copy a remote file:

# On your local computer - not gsafcomp01 or gsafcomp02
# Be sure to use your assigned student account and hostname

# copy "haiku.txt" from your remote student Home directory to your current local directory
scp student01@gsafcomp01.ccbb.utexas.edu:~/haiku.txt . 

# copy "haiku.txt", now in your local current directory, to your remote student 
# Home directory with the name "haiku2.txt"
scp ./haiku.txt student01@gsafcomp01.ccbb.utexas.edu:~/haiku2.txt

To copy a remote directory:

# On your local computer - not gsafcomp01 or gsafcomp02  # Be sure to use your assigned student account and hostname
 
# copy the "docs" directory and its contents from your remote student Home directory 
# to a local sub-directory called "local_docs"
scp -r student01@gsafcomp01.ccbb.utexas.edu:~/docs/ ./local_docs/

# copy the "local_docs" sub-directory in your local current directory, to your 
#  remote student Home directory with the name "remote_docs"
scp -r ./local_docs/ student01@gsafcomp01.ccbb.utexas.edu:~/remote_docs/

wget (web get)

The wget <url> command lets you retrieve the contents of a valid Internet URL (e.g. http, https, ftp).

• By default the downloaded file will be stored in the directory where you execute wget
  • with a filename based on the last component of the URL
• The -O <path> option specifies the file or pathname where the URL data should be written.

Example:

# Make a new "wget" directory in your student Home directory and change into it
mkdir -p ~/wget; cd ~/wget

# download a Gencode statistics file using default output file naming
wget "https://ftp.ebi.ac.uk/pub/databases/gencode/_README_stats.txt"
wc -l _README_stats.txt

# if you execute the same wget again, and the output file already exists
# wget will create a new one with a numeric extension
wget "https://ftp.ebi.ac.uk/pub/databases/gencode/_README_stats.txt"
wc -l _README_stats*

# download the same Gencode statistics file to a different local filename
wget -O gencode_stats.txt "https://ftp.ebi.ac.uk/pub/databases/gencode/_README_stats.txt"
wc -l gencode_stats.txt

The find command

The find command is a powerful – and of course complex! – way of looking for files in a nested directory hierarchy. The general form I use is:

find <in_directory> [ operators ] -name <expression> [  tests ]

• looks for files matching <expression> in <in_directory> and its sub-directories
• <expression> can be a double-quoted string including pathname wildcards (e.g. "[a-g]*.txt")
• there are tons of operators and tests:
  • -type f (file) and -type d (directory) are useful tests
  • -maxdepth NN is a useful operator to limit the depth of recursion.
• returns a list of matching pathnames in the <in_directory>, one per output line.

Examples:

cd
find . -name "*.txt" -type f     # find all .txt files in the Home directory
find . -name "*docs*" -type d    # find all directories with "docs" in the directory name

Exercise 2-1

The /stor/work/CBRS_unix/fastq/ directory contains sequencing data from a GSAF Job. Its structure, as shown by tree, is:

Use find to find all fastq.gz files in /stor/work/CBRS_unix/fastq/.

How many fastq.gz files in /stor/work/CBRS_unix/fastq/ were run in sequencer lane L001.

How many sample directories in /stor/work/CBRS_unix/fastq/ were run in 2020?

Working with symbolic links

When dealing with large data files, sometimes scattered in many directories, it is often convenient to create multiple symbolic links (symlinks) to those files in a directory where you plan to work with them. You can use them in your analysis as if they were local to your working directory, without the storage cost of copying them.

The ln -s <path_to_link_to> [ link_file_name ] command creates a symbolic link to <file_to_link_to>.

• ln -s <path> says to create a symbolic link (symlink) to the specified file (or directory) in the current directory
  • always use the -s option to avoid creating a hard link, which behaves quite differently
• the default link name corresponds to the last name component in <path>
  • you can name the link file differently by supplying an optional link_file_name.
• it is best to change into (cd) the directory where you want the link before executing ln -s
• a symbolic link can be deleted without affecting the linked-to file
• the -f (force) option says to overwrite any existing symbolic link with the same name

Examples:

# create a symlink to the ~/haiku.txt file using relative path syntax
mkdir -p ~/syms; cd ~/syms 
ln -s -f ../haiku.txt
ls -l

The ls -l long listing in the ~/syms directory displays the symlink like this:

• The 10-character permissions field (lrwxrwxrwx) has an l in the left-most file type position, indicating this is a symbolic link.
• The symlink itself is colored differently – in cyan
• There are two extra fields after the symlink name
  • field 10 has an arrow -> pointing to field 11
  • field 11 the path of the linked-to file ("../haiku.txt")

Now create a symlink to a non-existent file:

# create a symlink to a non-existent "../xxx.txt" file, naming the symlink "bad_link.txt"
mkdir -p ~/syms; cd ~/syms 
ln -sf ../xxx.txt bad_link.txt
ls -l

Now both the symlink and the linked-to file are displayed in red, indicating a broken link.

Multiple files can be linked by providing multiple file name arguments along and using the -t (target) option to specify the directory where links to all the files can be created.

# create a multiple symlinks to the *.bed files in the ~/data/bedfiles/ directory
# the -t . says create all the symlinks in the current directory
mkdir -p ~/syms; cd ~/syms  
ln -sf -t .  ../data/bedfiles/*.bed
ls -l

What about the case where the files you want are scattered in sub-directories? Consider a typical GSAF project directory structure, where FASTQ files are nested in sub-directories:

Here's a solution using find and xargs:

mkdir -p ~/syms/fa; cd ~/syms/fa
find /stor/work/CBRS_unix/fastq -name "*.gz" | xargs ln -sf -t .

Step by step:

• find returns a list of matching file paths on its standard output
• ln wants its files listed as arguments, not on standard input
  • so the paths are piped to the standard input of xargs
• xargs takes the data on its standard input and calls the specified function (here ln -sf -t .) with that data as the function's argument list.

About compressed files

Because a lot of scientific data is large, it is often stored in a compressed format to conserve storage space. The most common compression program used for individual files is gzip whose compressed files have the .gz extension. The tar and zip programs are most commonly used for compressing directories.

Let's see how that works by using a small FASTQ file that contains NGS read data where each sequence is represented by 4 lines.

# copy a small.fq file into a new ~/gzips directory
cd; mkdir gzips
cp -p /stor/work/CCBB_Workshops_1/misc_data/fastq/small.fq ~/gzips/
    
cd ~/gzips
ls -lh          # small.fq is 66K (~66,000) bytes long
wc -l small.fq  # small.fq is 1000 lines long

By default, when you call gzip on a file it compresses it in place, creating a file with the same name plus a .gz extension.

gzip small.fq   # compress the small.fq file in place, producing small.fq.gz file
ls -lh          # small.fq.gz is only 15K bytes -- 4x smaller!

The gunzip command does the reverse – decompresses the file and writes the results back without the .gz extension. gzip -d (decompress) does the same thing.

# decompress the small.fq.gz file in place, producing small.fq file
gunzip small.fq.gz    
# or
gzip -d small.fq.gz

Both gzip and gunzip also have -c or --stdout  options that tell the command to write on standard output, keeping the original files unchanged.

cd ~/gzips            # change into your ~/gzips directory
ls small.fq           # make sure you have an uncompressed "small.fq" file

gzip -c small.fq > sm2.fq.gz  # compress the "small.fq" into a new file called "sm2.fq.gz"
gunzip -c sm2.fq.gz > sm3.fq  # decompress "sm2.fq.gz" into a new "sm3.fq" file
ls -lh

Both gzip and gunzip can also accept data on standard input. In that case, the output is always on standard output.

cd ~/gzips            # change into your ~/gzips directory
ls small.fq           # make sure you have an uncompressed "small.fq" file

cat small.fq | gzip > sm4.fq.gz

The good news is that most bioinformatics programs can accept data in compressed gzipped format. But how do you view these compressed files?

• The less pager accepts gzipped files as input
• The zcat command is like cat, but works on gzipped files

Here are some ways to work with a compressed file:

cd ~/gzips                                    
cat ../jabberwocky.txt | gzip > jabber.gz  # make a compressed copy of "jabberwocky.txt"
less jabber.gz                             # use 'less' to view compressed "jabber.gz" 
                                           #   (type 'q' to exit)
zcat jabber.gz | wc -l                     # count lines in the compressed "jabber.gz" file
zcat jabber.gz | tail -4                   # view the last 4 lines of the "jabber.gz" file
zcat jabber.gz | cat -n                    # view "jabber.gz" text with line numbers 
                                           #   (zcat does not have an -n option)

Exercise 2-2

Display lines 7 - 9 of the compressed "jabber.gz" text

Working with 3rd party program I/O

Recall the three standard Unix streams: they each have a number, a name and redirection syntax:

3rd party tool files and streams

Third party bioinformatics tools are often written to perform sub-command processing; that is, they have a top-level program that handles multiple sub-commands. Examples include the bwa NGS aligner and the samtools and bedtools tool suites.

To see their menu of sub-commands, you usually just need to enter the top-level command, or <command> --help. Similarly, sub-command usage is usually available as <command> <sub-command> or <command> <sub-command> --help.

Now let's see how these concepts fit together when running 3rd party tools.

Exercise 2-3 bwa mem

Display the bwa mem sub-command usage using the more pager

Where does the bwa mem sub-command write its output?

How can this be changed?

bwa mem also writes diagnostic progress as it runs, to standard error. This is typical for tools that may run for an extended period of time.

cd ~/gzips
bwa mem /mnt/bioi/ref_genome/bwa/bwtsw/sacCer3/sacCer3.fa sm2.fq.gz > small.sam

Show how you would invoke bwa mem to capture both its alignment output and its progress diagnostics. Use input from a my_fastq.fq file and ./refs/hg38 as the <idxbase>.

Exercise 2-4 cutadapt

The cutadapt adapter trimming command reads NGS sequences from a FASTQ file, and writes adapter-trimmed reads to a FASTQ file. Find its usage.

Where does cutadapt write its output to from by default? How can that be changed?

Where does cutadapt read its input from by default? How can that be changed? Can the input FASTQ be in compressed format?

Where does cutadapt write its diagnostic output by default? How can that be changed?

cd ~/gzips 
cutadapt -a AGATCGGAAGAGCACACGTCTGA small.fq  > trimmed.fq