Page Comparison

Files and File systems

First, let's review Intro Unix: Files and File Systems. The most important takeaways are:

• Understanding the tree-like structure of directories and files in the file system hierarchy
  • Absolute paths start with a slash ( / ), the root of the file system hierarchy
    
  • More at: Intro Unix: Files and File Systems: The File System hierarchy
• Knowing how to navigate the file system using the cd (change directory) command, Tab key completion, and relative path syntax:
  • use the dot ( . ) metacharacter for the current directory
  • use the dot-dot ( .. ) metacharacters for the parent directory
  • More at:
    • Intro Unix: Files and File Systems: Navigating the file system
    • Intro Unix: Files and File Systems: Relative pathname syntax
• Selecting multiple files using pathname wildcards (a.k.a. "globbing")
  
  • asterisk ( * ) to match any length of characters
  • brackets ( [ ] ) match any character between the brackets, including hyphen ( - ) delimited character ranges such as [A-G]
  • More at: Intro Unix: Files and File Systems: Pathname wildcards (globbing)
• A basic understanding of file attributes such as
  • file type (file, directory)
  • owner and group
    
  • permissions (read, write, execute) for the owner, group and everyone
  • More at: Intro Unix: Files and File Systems: File attributes
• Familiarly with basic file manipulation commands (mkdir, cp, mv, rm)
  • Intro Unix: Files and File Systems: Basic file manipulation commands

Working with remote files

scp (secure copy)

The cp command only copies files/directories with the local host's file systems. The scp command is similar to cp, but scp lets you securely copy files from one machine to another. And also like cp, scp has a -r (recursive) option to copy directories.

scp usage is similar to cp in that it copies from a <source> to a <destination>, but uses remote machine addressing to qualify either the <source> or the <destination> but not both. Remote machine addressing looks like this: <user_account>@<hostname>:<source_or_destination>

Examples: 

Open a new Terminal (Mac) or Command Prompt (Window) window on your local computer (not logged in to your student account), and try the following, using your studentNN account and GSAF pod host.  Note that you will always be prompted for your credentials on the remote host when you execute an scp command.

...

...

Working with remote files

scp (secure copy)

The cp command only copies files/directories with the local host's file systems. The scp command is similar to cp, but scp lets you securely copy files from one machine to another. And also like cp, scp has a -r (recursive) option to copy directories.

scp usage is similar to cp in that it copies from a <source> to a <destination>, but uses remote machine addressing to qualify either the <source> or the <destination> but not both.

Remote machine addressing looks like this: <user_account>@<hostname>:<source_or_destination>

Examples: 

Open a new Terminal (Mac) or Command Prompt (Window) window on your local computer (not logged in to your student account), and try the following, using your studentNN account and GSAF pod host. 

Note that you will always be prompted for your credentials on the remote host when you execute an scp command.

To copy a remote file:

# On your local computer - not gsafcomp01 or gsafcomp02
# Be sure to use your assigned student account and hostname

# copy "haiku.txt" from your remote student Home directory to your current local directory
scp student01@gsafcomp01.ccbb.utexas.edu:~/haiku.txt . 

# copy "haiku.txt", now in your local current directory, to your remote student 
# Home directory with the name "haiku2.txt"
scp ./haiku.txt student01@gsafcomp01.ccbb.utexas.edu:~/haiku2.txt

To copy a remote directory:

# On your local computer - not gsafcomp01 or gsafcomp02  # Be sure to use your assigned student account and hostname
 
# copy the "docs" directory and its contents from your remote student Home directory 
# to youra current local sub-directory called "local_docs"
scp -r student01@gsafcomp01.ccbb.utexas.edu:~/haiku.txtdocs/ ./local_docs/


# copy "haiku.txt", nowthe "local_docs" sub-directory in your local current directory, to your 
#  remote student 
# Home directory with the name "haiku2.txtremote_docs"
scp -r ./haiku.txt/local_docs/ student01@gsafcomp01.ccbb.utexas.edu:~/haiku2.txt

# On your local computer - not gsafcomp01 or gsafcomp02

# copy the "docs" directory and its contents from your remote student Home directory 
# to a local sub-directory called "local_docs"
scp -r student01@gsafcomp01.ccbb.utexas.edu:~/docs/ ./local_docs/

# copy the "local_docs" sub-directory in your local current directory, to your 
#  remoteremote_docs/

wget (web get)

The wget <url> command lets you retrieve the contents of a valid Internet URL (e.g. http, https, ftp).

• By default the downloaded file will be stored in the directory where you execute wget
  • with a filename based on the last component of the URL
• The -O <path> option specifies the file or pathname where the URL data should be written.

Example:

# Make a new "wget" directory in your student Home directory withand thechange name "remote_docs"
scpinto it
mkdir -rp ./local_docs/ student01@gsafcomp01.ccbb.utexas.edu:~/remote_docs/

wget (web get)

The wget <url> command lets you retrieve the contents of a valid Internet URL (e.g. http, https, ftp).

• By default the downloaded file will be stored in the directory where you execute wget
  • with a filename based on the last component of the URL
• The -O <path> option specifies the file or pathname where the URL data should be written.

Example:

# Make a new "wget" directory in your student Home directory and change into it
mkdir -p ~/wget; cd ~/wget

# download a~/wget; cd ~/wget

# download a Gencode statistics file using default output file naming
wget "https://ftp.ebi.ac.uk/pub/databases/gencode/_README_stats.txt"
wc -l _README_stats.txt

# if you execute the same wget again, and the output file already exists
# wget will create a new one with a numeric extension
wget "https://ftp.ebi.ac.uk/pub/databases/gencode/_README_stats.txt"
wc -l _README_stats*

# download the same Gencode statistics file usingto defaulta outputdifferent filelocal namingfilename
wget -O gencode_stats.txt "https://ftp.ebi.ac.uk/pub/databases/gencode/_README_stats.txt"
wc -l gencode_README_stats.txt

# if you execute the same wget again, and the output file already exists
# wget will create a new one with a numeric extension
wget "https://ftp.ebi.ac.uk/pub/databases/gencode/_README_stats.txt"
wc -l _README_stats.txt.1

# download the same Gencode statistics file to a different local filename
wget -O gencode_stats.txt "https://ftp.ebi.ac.uk/pub/databases/gencode/_README_stats.txt"
wc -l gencode_stats.txt

The find command

The find command is a powerful – and of course complex! – way of looking for files in a nested directory hierarchy. The general form I use is:

find <in_directory> [ operators ] -name <expression> [  tests ]

...

Examples:

cd

The find command

The find command is a powerful – and of course complex! – way of looking for files in a nested directory hierarchy. The general form I use is:

find <in_directory> [ operators ] -name <expression> [  tests ]

• looks for files matching <expression> in <in_directory> and its sub-directories
• <expression> can be a double-quoted string including pathname wildcards (e.g. "[a-g]*.txt")
• there are tons of operators and tests:
  • -type f (file) and -type d (directory) are useful tests
  • -maxdepth NNis a useful operator to limit the depth of recursion.
• returns a list of matching pathnames in the <in_directory>, one per output line.

Examples:

cd
find . -name "*.txt" -type f     # find all .txt files in the Home directory
find . -name "*.txtdocs*" -type f d    # find all .txt files in the Home directory
find . -name "*docs*" -type d    # find all directories directories with "docs" in the directory name

...

...

• ln -s <path> says to create a symbolic link link (symlink) to the specified file (or directory) in the current directory
  • always use the -s option to avoid creating a hard link, which behaves quite differently
• the default link name corresponds to the last name component in <path>
  • you can name the link file differently by supplying an optional link_file_name.
• it is best to change into (cd) the directory where you want the link before executing ln -s
• a symbolic link can be deleted without affecting the linked-to file
• the -f (force) option says to overwrite any existing file symbolic link with the same name

Examples:

...

• The 10-character permissions field (lrwxrwxrwx) has an l in the left-most file type position, indicating this is a symbolic link.
• The symlink itself is colored differently – in cyan
• There are two extra fields after the symlink name
  • field 10 has an arrow -> pointing to ...field 11
  • field 11 the path of the linked-to file ("../haiku.txt")

...

# create a symlink to a non-existent "~../xxx.txt" file, naming the symlink "bad_link.txt"
mkdir -p ~/syms; cd ~/syms 
ln -sf ~../xxx.txt bad_link.txt
ls -l

Now both the symlink and the linked-to file are displayed in red, indicating a broken link.

Image RemovedImage Added

Multiple files can be linked by providing multiple file name arguments along and using the -t (target) option to specify the directory where links to all the files can be created.

...

• find returns a list of matching file paths on its standard output
• ln wants its files listed as arguments, not on standard input
  • so the paths are piped to the standard input of xargs
• xargs takes the data on its standard input and calls the specified function (here ln -sf -t .) with that data as the function's argument list.

...

Let's see how that works by using a small FASTQ file (~/data/fastq/small.fz) that contains NGS read data where each sequence is represented by 4 lines.

cd ~/data/fastq       # change into your ~/data/fastq directory
ls -lh small.fq       # copy a small.fq file into a new ~/gzips directory
cd; mkdir gzips
cp -p /stor/work/CCBB_Workshops_1/misc_data/fastq/small.fq ~/gzips/
    
cd ~/gzips
ls -lh          # small.fq is 66K (~66,000) bytes long
wc -l small.fq        # small.fq is 1000 lines long

...

gzip small.fq         # compress the small.fq file in place, producing small.fq.gz file
ls -lh small.fq.gz         # small.fq.gz is only 15K bytes -- 4x smaller!

The gunzip command does the reverse – decompresses the file and writes the results back without the .gz extension. gzip -d (decompress) does the same thing.

gunzip small.fq.gz    # # decompress the small.fq.gz file in place, producing small.fq file
gunzip small.fq.gz    
# or
gzip -d small.fq.gz

Both gzip and gunzip also have -c or --stdout  options that tell the command to write on standard output, keeping the original files unchanged.

cd ~/data/fastqgzips            # change into your ~/data/fastqgzips directory
ls small.fq           # make sure you have an uncompressed "small.fq" file

gzip -c small.fq > sm2.fq.gz  # compress the "small.fq" into a new file called "sm2.fq.gz"
gunzip -c sm2.fq.gz > sm3.fq  # decompress "sm2.fq.gz" into a new "sm3.fq" file
ls -lh

Both gzip and gunzip can also accept data on standard input. In that case, the output is always on standard output.

cd ~/data/fastqgzips            # change into your ~/data/fastqgzips directory
ls small.fq           # make sure you have an uncompressed "small.fq" file

cat small.fq | gzip > smallsm4.fq.gz

The good news is that most bioinformatics programs can accept data in compressed gzipped format. But how do you view these compressed files?

...

Here are some ways to work with a compressed file:

cd ~/gzips                                                     # make sure you're in your Home directory
cat    
cat ../jabberwocky.txt | gzip > jabber.gz  # make a compressed copy of the "jabberwocky.txt"
file
less jabber.gz                             # use 'less' to view the compressed "jabber.gz" file
(q to exit)  zcat jabber.gz | wc -l                       #             #   (type 'q' to exit)
zcat jabber.gz | wc -l                     # count lines in the compressed "jabber.gz" file
zcat jabber.gz | tail -4                     # view the last 4 lines of the "jabber.gz" file
zcat jabber.gz | cat -n                      # view "jabber.gz" text with line numbers 
(no zcat -n option)
zcat jabber.gz | cat -n | tail +6 | head -4  # display lines 6 - 9 of "jabber.gz" text

Exercise 1-1

Display lines 6 - 9 of the compressed "jabber.gz" text

Working with 3rd party program I/O

Recall the three standard Unix streams: they each have a number, a name and redirection syntax:

Image Removed

• standard output is stream 1
  • redirect standard output to a file with a the > or 1> operator
    • a single > or 1> overwrites any existing data in the target file
    • a double >> or 1>> appends to any existing data in the target file
• standard error is stream 2
  • redirect standard error to a file with a the 2> operator
    • a single 2> overwrites any existing data in the target file
    • a double 2>> appends to any existing data in the target file

We also saw that 3rd party bioinformatics tools are often written as a top-level program that handles multiple sub-commands. Examples include the bwa NGS aligner and samtools and bedtools tool suites. To see their menu of sub-commands, you usually just need to enter the top-level command, or <command> --help. Similarly, sub-command usage is usually available as <command> <sub-command> or <command> <sub-command> --help.

Now let's see how these concepts fit together when running 3rd party tools.

Exercise 1-1 bwa aln

...

                                          #   (zcat does not have an -n option)

Exercise 2-2

Display lines 7 - 9 of the compressed "jabber.gz" text

Working with 3rd party program I/O

Recall the three standard Unix streams: they each have a number, a name and redirection syntax:

Image Added

3rd party tool files and streams

Third party bioinformatics tools are often written to perform sub-command processing; that is, they have a top-level program that handles multiple sub-commands. Examples include the bwa NGS aligner and the samtools and bedtools tool suites.

To see their menu of sub-commands, you usually just need to enter the top-level command, or <command> --help. Similarly, sub-command usage is usually available as <command> <sub-command> or <command> <sub-command> --help.

Now let's see how these concepts fit together when running 3rd party tools.

Exercise 2-3 bwa mem

Display the bwa mem sub-command usage using the more pager

Where does the bwa mem sub-command write its output?

How can this be changed?

bwa mem also writes diagnostic progress as it runs, to standard error.

cd ~/gzips
bwa mem /mnt/bioi/ref_genome/bwa/bwtsw/sacCer3/sacCer3.fa sm2.fq.gz > small.sam

Show how you would invoke bwa mem to capture both its alignment output and its progress diagnostics. Use input from a my_fastq.fq file and ./refs/hg38 as the <idxbase>.

Exercise 2-4 cutadapt

The cutadapt adapter trimming command reads NGS sequences from a FASTQ file, and writes adapter-trimmed reads to a FASTQ file. Find its usage.

Where does cutadapt write its output to from by default? How can that be changed?

Where does cutadapt read its input from by default? How can that be changed? Can the input FASTQ be in compressed format?

How can this be changed?

bwa aln also writes diagnostic progress as it runs, to standard error. Show how you would invoke bwa aln to capture both its alignment output and its progress diagnostics. Use input from a my_fastq.fq file and ./refs/hg38 as the <prefix>.

Exercise 1-2 cutadapt

The cutadapt adapter trimming command reads NGS sequences from a FASTQ file, and writes adapter-trimmed reads to a FASTQ file. Find its usage.

Where does cutadapt write its output to from by default? How can that be changed?

Where does fastx_trimmer write its input from by default? How can that be changed?

Where does cutadapt write its diagnostic output by default? How can that be changed?

cd ~/gzips 
cutadapt -a AGATCGGAAGAGCACACGTCTGA small.fq  > trimmed.fq